This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCAAGCTGACAAATCAATT and ATTATCACGCTTGTAAAGAA, which resulted in a 136 bp deletion beginning at Chromosome 6 position 83,934,897 bp and ending after 83,935,032 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000194351 (exon 3) and 74 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 437 and early truncation 2 amino acids later. (J:188991)