This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTATGTCACAGACAAGAA and GGCTAGTGCGGGAGAATCCG, which resulted in a 1322 bp deletion beginning at Chromosome 4 position 80,910,589 bp and ending after 80,911,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000405695 (exon 1) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)