Fam168a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCTCAGTCCTGGTGCCCAT and GCTGGAGGCTCCCGGAGAAG, which resulted in a 432 bp deletion beginning at Chromosome 7 position 100,831,131 bp and ending after 100,831,562 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000335948 (exon 6) and 289 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 and truncation 116 amino acids later. (J:188991)