Igf2bp1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATATATGCAGTTTTGAACG and GCAAACAAGCAACACCCAGT, which resulted in a 598 bp deletion beginning at Chromosome 11 position 95,974,993 bp and ending after 95,975,590 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289477 (exon 5) and 534 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 3 amino acids later. (J:188991)