This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCGCAGCCATAGAATCCTGG and GGGTACCAGCTCCTTCCAGG, which resulted in a 341 bp deletion beginning at Chromosome 16 position 32,497,382 bp and ending after 32,497,722 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000455696 (exon 3) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 56 amino acids later. (J:188991)