This allele from project TCPR1301 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGTGGTCCTTCACCTATCA and TCCATCACCTGTAGTTCCCC targeting the 5' side and GAGAAAATCTACGTTTTACA and CATCAAAGGGTTGCATGCCA targeting the 3' side of a critical region. This resulted in a 1446-bp del Chr6: 95121396-95122841 with 24-bp insert at deletion junction (GRCm38). (J:265051)