CRISPR-targeting of exon 45 with an sgRNA (targeting GATCTCAAAGCAGCTACCCC) and an ssODN template engineered nucleotide substitutions to produce a G-to-C silent mutation creating an AfIII reaction enzyme site, C-to-A resulting in the amino acid substitution of phenylalanine with leucine at position 2108 (p.F2108L) and several silent mutations to prevent Cas9 recutting. The amino acid substitution produces rapamycin resistance in the encoded peptide. (J:259205)