This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGAACCACATTCTTGAG and GAGCAGGTACCATGATCCTG, which resulted in a 718 bp deletion beginning at Chromosome 2 position 181,308,568 bp and ending after 181,309,285 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000661112 and ENSMUSE00000591048 (exons 2 and 3) and 446 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 14 amino acids later. (J:188991)