This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAATCTGAAGCCTCACAT and GTCTTGACTGAGTTCCTAAA, which resulted in a 481 bp deletion beginning at Chromosome 8 position 119,578,971 bp and ending after 119,579,451 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000318922 (exon 3) and 389 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 81and early truncation 1 amino acid later. (J:188991)