This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGAGAAGATACCTAGAGG and GTAAATTACATCAGATGATA, which resulted in a 2002 bp deletion beginning at Chromosome 11 position 62,117,560 bp and ending after 62,119,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000238537 (exon 4) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 10 amino acids later. (J:188991)