Bcap29^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAAAAGATCTTAGTGTAAG and ACCCTGTCAGGTACTAAAGA, which resulted in a 355 bp deletion beginning at Chromosome 12 position 31,626,659 bp and ending after 31,627,013 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000107429 (exon 4) and 204 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 2 amino acids later. There is a 3 bp insertion (CTG) at the deletion site. (J:188991)