Cfap418^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGCTGTCACTCTAGCAGT and TGAGGAGTACAGGTAAAGAA, which resulted in a 505 bp deletion beginning at Chromosome 4 position 10,879,214 bp and ending after 10,879,718 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279296 (exon 2) and 417 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 53 amino acids later. (J:188991)