This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGCTTAGATTGCCCCCAA and TTAGTCAACTGAAATTAATG, which resulted in a 254 bp deletion beginning at Chromosome 1 position 71,353,549 bp and ending after 71,353,802 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000441018 (exon 4) and 162 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 8 amino acids later. (J:188991)