Txndc11^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCCTGGCATGAGGTCAAG and GTAAATAATGACACGCTCCA, which resulted in a 631 bp deletion beginning at Chromosome 16 position 11,128,323 bp and ending after 11,128,953 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000383733 (exon 2) and 414 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 6 amino acids later. (J:188991)