This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCACACTCATGATATGAT and AAGAACTTACATTATCCACA, which resulted in a 365 bp deletion beginning at Chromosome 11 position 28,433,827 bp and ending after 28,434,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000283791 (exon 3) and 288 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 405 and early truncation 3 amino acids later. (J:188991)