This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCACTCCTCACTAAAGCC and GTCACTATAGCTGAGCTCGA, which resulted in a 323 bp deletion beginning at Chromosome 17 position 31,648,622 bp and ending after 31,648,944 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000137465 and ENSMUSE00000137461 (exons 4 and 5) and 174 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 3 amino acids later. There is a single base pair, A, insertion at the deletion site. (J:188991)