Slc17a2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGGTTCTTAGTTAGTAG and CCTACATCAGTCAAAGGCTG, which resulted in a 640 bp deletion beginning at Chromosome 13 position 23,814,821 bp and ending after 23,815,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE0000124538 and ENSMUSE00001248222 (exons 4 and 5) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 14 amino acids later. (J:188991)