Arhgef10l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTCTGACTTGAAACGGAA and CCCGCCCCTCGAAGGAACCA, which resulted in a 413 bp deletion beginning at Chromosome 4 position 140,610,248 bp and ending after 140,610,660 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000335941 (exon 4) and 379 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 43 amino acids later. (J:188991)