Zfp652^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCATCCTACCTCCTGGCAG and AGTGCTCTCTGCTCCACATT, which resulted in a 273 bp deletion beginning at Chromosome 11 position 95,752,809 bp and ending after 95,753,081 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000674206 (exon 2) and 125 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 299 and early truncation 54 amino acids later. (J:188991)