Tifa^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCAGTCTTATAATGTGGA and GACTGGTGATCTGCAGCAAG, which resulted in a 2018 bp deletion beginning at Chromosome 3 position 127,796,415 bp and ending after 127,798,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001352154 (exon 3) and 197 bp of flanking intronic sequence including the splice acceptor and start of translation and is predicted to result in a null allele. (J:188991)