This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAGACTAATTGGGTAGCCG and TGATATCTCTGCCCAGACTA, which resulted in a 387 bp deletion beginning at Chromosome 9 position 104,082,662 bp and ending after 104,083,048 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001068374 (exon 8) and 280 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 320 and early truncation 9 amino acids later. (J:188991)