This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATACACATGCTTCATGCCG and TCAGGGCAAATGTTTTTCTA, which resulted in a 347 bp deletion beginning at Chromosome 9 position 65,042,099 bp and ending after 65,042,445 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000532750 (exon 4) and 234 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 29 amino acids later. (J:188991)