This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAAATTTATCTCAAAGCTG and ATATAGGTAATTTAACTAAG, which resulted in a 763 bp deletion beginning at Chromosome 18 position 22,823,125 bp and ending after 22,823,887 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000625642 (exon 6) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 257 and early truncation 9 amino acids later. (J:188991)