This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCCCTGAGAAAGGATGGG and GCTGAAGTTGGCATCCCAGG, which resulted in a 2325 bp deletion beginning at Chromosome 7 position 19,522,850 bp and ending after 19,525,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000476801 (exon 4) and 245 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 71 amino acids later. (J:188991)