Serinc5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGTTAGAACTAGGCTGAG and ATAAAACTCTTCTTCACGGT, which resulted in a 441 bp deletion beginning at Chromosome 13 position 92,682,714 bp and ending after 92,683,154 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000304535 (exon 3) and 259 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 4 amino acids later. (J:188991)