This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCAGGACAAAGATCACCA and GCTGCTTTGTGGTTTTATAT, which resulted in a 1406 bp deletion beginning at Chromosome 3 position 90,541,810 bp and ending after 90,543,215 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000637998 and ENSMUSE00000637995 (exons 2 and 3) and 440 bp of flanking intronic sequence including the splice acceptor translation start and is predicted to result in a null allele. (J:188991)