Wdfy1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGACATGACTAATACGG and GGTTTATGATAGCCTGCCAG, which resulted in a 325 bp deletion beginning at Chromosome 1 position 79,739,934 bp and ending after 79,740,258 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001057763 (exon 2) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 20 amino acids later. There is a 10 bp (AATCATCTCA) insertion at the deletion site. (J:188991)