This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGACTTAAGTACAAGT and TTGACTCTCACACATCAGAG, which resulted in a 377 bp deletion beginning at Chromosome 12 position 73,291,923 bp and ending after 73,292,299 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365160 (exon 3) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 39 amino acids later. (J:188991)