Tom1l1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCTATAAATAAGATTGCGG and TGTGATCTATCAATTTTGGA, which resulted in a 284 bp deletion beginning at Chromosome 11 position 90,683,198 bp and ending after 90,683,481 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000106324 (exon 3) and 205 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 15 amino acids later. (J:188991)