Serinc2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACAAAAGCCCCCCCCCAG and TTAGTGTTTAGAGCAACACG, which resulted in a 342 bp deletion beginning at Chromosome 4 position 130,264,223 bp and ending after 130,264,564 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000312129 (exon 3) and 151 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 4 amino acids later. (J:188991)