Ubac1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAATTGGGTGTTCTAGTAG and GCAGATTTAAGCAAGTTTGT, which resulted in a 873 bp deletion beginning at Chromosome 2 position 26,008,577 bp and ending after 26,009,449 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001223421 and ENSMUSE00000236713 (exons 5 and 6) and 661 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 11 amino acids later. (J:188991)