This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATCTACCGCGTTTGAGGG and TGTGTTAGAGATGGTCTGAA, which resulted in a 521 bp deletion beginning at Chromosome 1 position 165,187,898 bp and ending after 165,188,418 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000229846 and ENSMUSE00000229842 (exons 2 and 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 15 amino acids later. (J:188991)