This allele from project TCPR1259 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGTAGTATTACCGAAGAGGA and ATGCCGTTCTGAGGTCTCTA targeting the 5' side and AGCCCAGCACCCTAATGAAC and ATGCAGCACCTACGCCATGG targeting the 3' side of a critical exon(s). This resulted in a 1226-bp deletion on Chr2 from 130395605 to 130396830 (GRCm38). (J:265051)