Lurap1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTCATTATTTGTCTCCCAA and ACCTCGCTCCCCCAACTGCG, which resulted in a 566 bp deletion beginning at Chromosome 4 position 116,144,128 bp and ending after 116,144,693 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000337750 (exon 1) and 253 bp of flanking intronic sequence including the translation start and is predicted to result in a null allele. (J:188991)