This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACCTGCTAATGAACCCCA and ATAGTTATGTCATTAACCCC, which resulted in a 631 bp deletion beginning at Chromosome 8 position 93,530,546 bp and ending after 93,531,176 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000467055 (exon 3) and 492 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 and early truncation 37 amino acids later. (J:188991)