This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTCCTGCATGTTCTCAA and GTCACTCCCCAAAAGCCCAT, which resulted in a 405 bp deletion beginning at Chromosome 8 position 92,864,810 bp and ending after 92,865,214 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279785 (exon 2) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 63 amino acids later. (J:188991)