1700093K21Rik^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAAGAATGAAAGCTAACAG and GTCCTAGCCATTATTATTTG, which resulted in a 389 bp deletion beginning at Chromosome 11 position 23,517,072 bp and ending after 23,517,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000103081 (exon 4) and 220 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 22 amino acids later. (J:188991)