Cox18^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATCACTATGCTGCATGG and GTTGTTTGATGAGTTCATAA, which resulted in a 241 bp deletion beginning at Chromosome 5 position 90,222,124 bp and ending after 90,222,364 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000542644 (exon 2) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 108 and early truncation 17 amino acids later. (J:188991)