This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCCTCTTAGATAAACAA and CAGGTGTGACAGGTACGCAG, which resulted in a 637 bp deletion beginning at Chromosome 3 position 152,127,850 bp and ending after 152,128,486 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000260054 (exon 3) and 456 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 1 amino acid later. (J:188991)