Cox16^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GTAACACGCGCGTTCACGAA and GCTAATGCACAAGTAGCACC, which resulted in a 645 bp deletion beginning at Chromosome 12 position 81,484,671 bp and ending after 81,485,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000912604 (exon 1) and 421 bp of flanking intronic sequence including the translation start site and is predicted to generate a null allele. (J:188991)