This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACATGCTGGGCCTCAGAG and CAATGCCTCTTATCAGACCT, which resulted in a 549 bp deletion beginning at Chromosome 1 position 33,877,979 bp and ending after 33,878,527 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001230072 (exon 3) and 371 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 61 amino acids later. (J:188991)