This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGCCATAGATTTCTCCAC and GGAAACTCCAGTCTTAAGAG, which resulted in a 562 bp deletion beginning at Chromosome 10 position 85,995,684 bp and ending after 85,996,245 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000398325 (exon 3) and 441 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. (J:188991)