This allele from project TCPR1239 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCAGGAGATTCGACTTCAGG and TAGAATATTCAGCGGCCTAG targeting the 5' side and ATATGGATAAGGCGACATTT and ATCCCATCAGGCTGGCTGAA targeting the 3' side of a critical region. This resulted in a 757-bp del Chr11: 62852806 to 62853562 (GRCm38). (J:265051)