This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCATTCATTTTTCAGTG and AGCCAATAGTGACAACACAA, which resulted in a 490 bp deletion beginning at Chromosome 14 position 27,001,112 bp and ending after 27,001,601 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000249582 (exon 2) and 200 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 8 amino acids later. (J:188991)