This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCTAAGGAAGGGCTA and CATTACTGTTTCATAAGCCA, which resulted in a 223 bp deletion beginning at Chromosome 15 position 78,957,051 bp and ending after 78,957,273 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001213855 (exon 4) and 123 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 8 and early truncation 141 amino acids later. In addition, there is a single (G) bp insertion at the deletion site. (J:188991)