Ccdc172^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACAAGCTGTCCAGACGT and TTCCAGGTCAGCGTGTGTAA, which resulted in a 2258 bp deletion beginning at Chromosome 19 position 58,525,572 bp and ending after 58,527,829 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147905 and ENSMUSE00000147900 (exons 4,5) and 1975 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 1 amino acid later. (J:188991)