This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGATTTCCCTTACATGCCA and TATTGGGGAGAATTTATGTA, which resulted in a 416 bp deletion beginning at Chromosome 12 position 70,159,096 bp and ending after 70,159,511 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266293 (exon 2) and 288 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 26 amino acids later. (J:188991)