This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGGTGTTACGTGAACCT and GCCCACAGTGGCAGTCCCAA, which resulted in a 1906 bp deletion beginning at Chromosome 9 position 106,451,319 bp and ending after 106,453,224 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374711 and ENSMUSE00000345857 (exons 3 and 4) and 724 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 33 amino acids later. (J:188991)