Atp8a2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTATAAAACAAACGTGGGA and ACTGCATGTCCTTTGTAGGA, which resulted in a 365 bp deletion beginning at Chromosome 14 position 60,046,495 bp and ending after 60,046,859 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000418148 (exon 2) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 20 amino acids later. (J:188991)