This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCCACCAAGTTTTCAGGG and CGAGCATCCATACAGCTCTG, which resulted in a 261 bp deletion beginning at Chromosome 9 position 104,005,379 bp and ending after 104,005,639 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001248887 (exon 3) and 110 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 19 amino acids later. (J:188991)